92
|
Hycult Biotech
cpg a dna Cpg A Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpg a dna/product/Hycult Biotech Average 92 stars, based on 1 article reviews
cpg a dna - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
90
|
TriLink
cpg odn-2216 type a class Cpg Odn 2216 Type A Class, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpg odn-2216 type a class/product/TriLink Average 90 stars, based on 1 article reviews
cpg odn-2216 type a class - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biomol GmbH
cpg odn 2216 Cpg Odn 2216, supplied by Biomol GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpg odn 2216/product/Biomol GmbH Average 90 stars, based on 1 article reviews
cpg odn 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Hokkaido System Science Co
oligodeoxynucleotides odn-2216 Oligodeoxynucleotides Odn 2216, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligodeoxynucleotides odn-2216/product/Hokkaido System Science Co Average 90 stars, based on 1 article reviews
oligodeoxynucleotides odn-2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
phosphorothioate-modified cpg-odn 2216 (gggggacgatcgtcgggggg) Phosphorothioate Modified Cpg Odn 2216 (Gggggacgatcgtcgggggg), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phosphorothioate-modified cpg-odn 2216 (gggggacgatcgtcgggggg)/product/MWG-Biotech ag Average 90 stars, based on 1 article reviews
phosphorothioate-modified cpg-odn 2216 (gggggacgatcgtcgggggg) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
cpg-a odn 2216 Cpg A Odn 2216, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpg-a odn 2216/product/Eurofins Average 90 stars, based on 1 article reviews
cpg-a odn 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Enzo Biochem
unmethylated type a cpg (cpg-a) oligodeoxynucleotide (odn) 2216 Unmethylated Type A Cpg (Cpg A) Oligodeoxynucleotide (Odn) 2216, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/unmethylated type a cpg (cpg-a) oligodeoxynucleotide (odn) 2216/product/Enzo Biochem Average 90 stars, based on 1 article reviews
unmethylated type a cpg (cpg-a) oligodeoxynucleotide (odn) 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
cpg-a odn 2216 Cpg A Odn 2216, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpg-a odn 2216/product/GeneWorks Average 90 stars, based on 1 article reviews
cpg-a odn 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Enzo Biochem
25 μg of cpg 2216 (g* g*gggacgatcgtcg* g*g*g*g*g (*: phosphothiolate modification) 25 μg Of Cpg 2216 (G* G*Gggacgatcgtcg* G*G*G*G*G (*: Phosphothiolate Modification), supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/25 μg of cpg 2216 (g* g*gggacgatcgtcg* g*g*g*g*g (*: phosphothiolate modification)/product/Enzo Biochem Average 90 stars, based on 1 article reviews
25 μg of cpg 2216 (g* g*gggacgatcgtcg* g*g*g*g*g (*: phosphothiolate modification) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
PBL Biomedical Laboratories
cpg-odn 2216 Cpg Odn 2216, supplied by PBL Biomedical Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpg-odn 2216/product/PBL Biomedical Laboratories Average 90 stars, based on 1 article reviews
cpg-odn 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
LabForce AG
class a cpg odn 2216 Class A Cpg Odn 2216, supplied by LabForce AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/class a cpg odn 2216/product/LabForce AG Average 90 stars, based on 1 article reviews
class a cpg odn 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Vivogen Biotechnology Inc
synthetic oligodeoxynucleotide containing cpg motifs (cpg odn) 2216 Synthetic Oligodeoxynucleotide Containing Cpg Motifs (Cpg Odn) 2216, supplied by Vivogen Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic oligodeoxynucleotide containing cpg motifs (cpg odn) 2216/product/Vivogen Biotechnology Inc Average 90 stars, based on 1 article reviews
synthetic oligodeoxynucleotide containing cpg motifs (cpg odn) 2216 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |