cpg odn 2216 Search Results


92
Hycult Biotech cpg a dna
Cpg A Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg a dna/product/Hycult Biotech
Average 92 stars, based on 1 article reviews
cpg a dna - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
TriLink cpg odn-2216 type a class
Cpg Odn 2216 Type A Class, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn-2216 type a class/product/TriLink
Average 90 stars, based on 1 article reviews
cpg odn-2216 type a class - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Biomol GmbH cpg odn 2216
Cpg Odn 2216, supplied by Biomol GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn 2216/product/Biomol GmbH
Average 90 stars, based on 1 article reviews
cpg odn 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Hokkaido System Science Co oligodeoxynucleotides odn-2216
Oligodeoxynucleotides Odn 2216, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligodeoxynucleotides odn-2216/product/Hokkaido System Science Co
Average 90 stars, based on 1 article reviews
oligodeoxynucleotides odn-2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag phosphorothioate-modified cpg-odn 2216 (gggggacgatcgtcgggggg)
Phosphorothioate Modified Cpg Odn 2216 (Gggggacgatcgtcgggggg), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phosphorothioate-modified cpg-odn 2216 (gggggacgatcgtcgggggg)/product/MWG-Biotech ag
Average 90 stars, based on 1 article reviews
phosphorothioate-modified cpg-odn 2216 (gggggacgatcgtcgggggg) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eurofins cpg-a odn 2216
Cpg A Odn 2216, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a odn 2216/product/Eurofins
Average 90 stars, based on 1 article reviews
cpg-a odn 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Enzo Biochem unmethylated type a cpg (cpg-a) oligodeoxynucleotide (odn) 2216
Unmethylated Type A Cpg (Cpg A) Oligodeoxynucleotide (Odn) 2216, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/unmethylated type a cpg (cpg-a) oligodeoxynucleotide (odn) 2216/product/Enzo Biochem
Average 90 stars, based on 1 article reviews
unmethylated type a cpg (cpg-a) oligodeoxynucleotide (odn) 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GeneWorks cpg-a odn 2216
Cpg A Odn 2216, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a odn 2216/product/GeneWorks
Average 90 stars, based on 1 article reviews
cpg-a odn 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Enzo Biochem 25 μg of cpg 2216 (g* g*gggacgatcgtcg* g*g*g*g*g (*: phosphothiolate modification)
25 μg Of Cpg 2216 (G* G*Gggacgatcgtcg* G*G*G*G*G (*: Phosphothiolate Modification), supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/25 μg of cpg 2216 (g* g*gggacgatcgtcg* g*g*g*g*g (*: phosphothiolate modification)/product/Enzo Biochem
Average 90 stars, based on 1 article reviews
25 μg of cpg 2216 (g* g*gggacgatcgtcg* g*g*g*g*g (*: phosphothiolate modification) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PBL Biomedical Laboratories cpg-odn 2216
Cpg Odn 2216, supplied by PBL Biomedical Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-odn 2216/product/PBL Biomedical Laboratories
Average 90 stars, based on 1 article reviews
cpg-odn 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
LabForce AG class a cpg odn 2216
Class A Cpg Odn 2216, supplied by LabForce AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/class a cpg odn 2216/product/LabForce AG
Average 90 stars, based on 1 article reviews
class a cpg odn 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Vivogen Biotechnology Inc synthetic oligodeoxynucleotide containing cpg motifs (cpg odn) 2216
Synthetic Oligodeoxynucleotide Containing Cpg Motifs (Cpg Odn) 2216, supplied by Vivogen Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic oligodeoxynucleotide containing cpg motifs (cpg odn) 2216/product/Vivogen Biotechnology Inc
Average 90 stars, based on 1 article reviews
synthetic oligodeoxynucleotide containing cpg motifs (cpg odn) 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results